1、医用分子遗传学转录和转录后修饰Post-transcriptional Processing of RNAMaking ends of RNARNA splicingPrimary Transcript Primary Transcript-the initial molecule of RNA produced-hnRNA（heterogenous nuclear RNA）In prokaryotes,DNA RNA protein in cytoplasm concurrently In eukaryotes nuclear RNA Cp RNA Processing of eukaryo
2、tic pre-mRNAHuman dystrophin gene has 79 exons,spans over 2,300-Kb and requires over 16 hours to be transcribed!For primary transcripts containing multiple exons and introns,splicing occurs before transcription of the gene is complete-co-transcriptional splicing.Types of RNA processingA)Cutting and
3、trimming to generate ends:rRNA,tRNA and mRNAB)Covalent modification:Add a cap and a polyA tail to mRNAAdd a methyl group to 2-OH of ribose in mRNA and rRNAExtensive changes of bases in tRNAC)Splicingpre-rRNA,pre-mRNA,pre-tRNA by different mechanisms.The RNA Pol II CTD is required for the coupling of
4、 transcription with mRNA capping,polyadenylation and splicing The coupling allows the processing factors to present at high local concentrations when splice sites and poly(A)signals are transcribed by Pol II,enhancing the rate and specificity of RNA processing.The association of splicing factors wit
5、h phosphorylated CTD also stimulates Pol II elongation.Thus,a pre-mRNA is not synthesized unless the machinery for processing it is properly positioned.Time course of RNA processing 5 and 3 ends of eukaryotic mRNAAdd a GMPMethylate it and1st few nucleotidesCut the pre-mRNAand add As5-UTR3-UTRCapping
6、 of pre-mRNAs Cap=modified guanine nucleotide Capping=first mRNA processing event-occurs during transcription CTD recruits capping enzyme as soon as it is phosphorylated Pre-mRNA modified with 7-methyl-guanosine triphosphate(cap)when RNA is only 25-30 bp long Cap structure is recognized by CBC（cap-b
7、inding complex）stablize the transcript prevent degradation by exonucleases stimulate splicing and processingSometimesmethylatedSometimesmethylated The cap is added after the nascent RNA molecules produced by RNA polymerase II reach a length of 25-30 nucleotides.Guanylyltransferase is recruited and a
8、ctivated through binding to the Ser5-phosphorylated Pol II CTD.The methyl groups are derived from S-adenosylmethionine.Capping helps stabilize mRNA and enhances translation,splicing and export into the cytoplasm.Capping of the 5 end of nascent RNA transcripts with m7GExisting in a single complexCons
9、ensus sequence for 3 processAAUAAA:CstF(cleavage stimulation factor F)GU-rich sequence:CPSF(cleavage and polyadenylation specificity factor)Polyadenylation of mRNA at the 3 endCPSF:cleavage and polyadenylation specificity factor.CStF:cleavage stimulatory factor.CFI&CFII:cleavage factor I&II.PAP:poly
10、(A)polymerase.PABPII:poly(A)-binding protein II.Poly(A)tail stabilizes mRNA and enhances translation and export into the cytoplasm.RNA is cleaved 1035-nt 3 to A2UA3.The binding of PAP prior to cleavage ensures that the free 3 end generated is rapidly polyadenylated.PAP adds the first 12A residues to
11、 3-OH slowly.Binding of PABPII to the initial short poly(A)tail accelerates polyadenylation by PAP.The polyadenylation complex is associated with the CTD of Pol II following initiation.Functions of 5 cap and 3 polyA Need 5 cap for efficient translation:Eukaryotic translation initiation factor 4(eIF4
12、)recognizes and binds to the cap as part of initiation.Both cap and polyA contribute to stability of mRNA:Most mRNAs without a cap or polyA are degraded rapidly.Shortening of the polyA tail and decapping are part of one pathway for RNA degradation in yeast.mRNA Half-life t seconds if seldom needed t
13、 several cell generations(i.e.48-72 h)for houskeeping gene avg 3 h in eukaryotes avg 1.5 min in bacteria Poly(A)+RNA can be separated from other RNAs by fractionation on Sepharose-oligo(dT).Split gene and mRNA splicing Background:Adenovirus has a DNA genome andmakes many mRNAs.Can we determine which
14、part of the genome encodes for each mRNA bymaking a DNA:RNA hybrid?Experiment:Isolate Adenovirus genomic DNA,isolate one adenovirus mRNA,hybridize and then look by EM at where the RNA hybridizes(binds)to the genomic DNA.Surprise:The RNA is generated from 4 different regions of the DNA!How can weexpl
15、ain this?Splicing!The discovery of split genes(1977)1993 Noble Prize in Medicine To Dr.Richard Robert and Dr.Phillip SharpThe matured mRNAs are much shorter than the DNA templates.DNAmRNAExon and Intron Exon is any segment of an interrupted gene that is represented in the mature RNA product.Intron i
16、s a segment of DNA that is transcribed,but removed from within the transcript by splicing together the sequences(exons)on either side of it.Exons aresimilar in sizeIntrons are highlyvariable in sizeGT-AG rule GT-AG rule describes the presence of these constant dinucleotides at the first two and last
17、 two positions of introns of nuclear genes.Splice sites are the sequences immediately surrounding the exon-intron boundaries Splicing junctions are recognized only in the correct pairwise combinationsThe sequence of steps in the production of mature eukaryotic mRNA as shown for the chicken ovalbumin
18、 gene.The consensus sequence at the exonintron junctions of vertebrate pre-mRNAs.4 major types of introns 4 classes of introns can be distinguished on the basis of their mechanism of splicing and/or characterisitic sequences:Group I introns in fungal mitochondria,plastids,and in pre-rRNA in Tetrahym
19、ena(self-splicing)Group II introns in fungal mitochondria and plastids(self-splicing)Introns in pre-mRNA(spliceosome mediated)Introns in pre-tRNAGroup I and II intronsThe sequence of transesterification reactions that splice together the exons of eukaryotic pre-mRNAs.Splicing of Group I and II intro
20、ns Introns in fungal mitochondria,plastids,Tetrahymena pre-rRNA Group I Self-splicing Initiate splicing with a G nucleotide Uses a phosphoester transfer mechanism Does not require ATP hydrolysis.Group II self-splicing Initiate splicing with an internal A Uses a phosphoester transfer mechanism Does n
21、ot require ATP hydrolysisSelf-splicing in pre-rRNA in Tetrahymena:T.Cech et al.1981Exon 1Exon 2Intron 1Exon 1 Exon 2Intron 1+pre-rRNASpliced exonIntron circleIntron linearpre-rRNANuclear extractGTP+-+-+-+-Products of splicing were resolved by gel electrophoresis:Additional proteinsare NOT needed for
22、splicing of this pre-rRNA!Do need a G nucleotide(GMP,GDP,GTP or Guanosine).The sequence of reactions in the self-splicing of Tetrahymena group I intron.Where is the catalytic activity in RNase P?RNase P is composed of a 375 nucleotide RNA and a 20 kDa protein.The protein component will NOT catalyze
23、cleavage on its own.The RNA WILL catalyze cleavage by itself!The protein component aids in the reaction but is not required for catalysis.Thus RNA can be an enzyme.Enzymes composed of RNA are called ribozymes.Hammerhead ribozymes A 58 nt structure is used in self-cleavage The sequence CUGA adjacent
24、to stem-loops is sufficient for cleavage CUGAGACCGGGGCCAAAACUC GAGUCACCACUGGUGUBond that is cleaved.53CUGA is required for catalysisMechanism of hammerhead ribozyme The folded RNA forms an active site for binding a metal hydroxide Attracts a proton from the 2 OH of the nucleotide at the cleavage sit
25、e.This is now a nucleophile for attack on the 3 phosphate and cleavage of the phosphodiester bond.1989 Nobel Prize in chemistry,Sidney Altman,and Thomas Cech Distribution of Group I introns Prokaryotes eubacteria(tRNA&rRNA),phage Eukaryotes lower(algae,protists,&fungi)nuclear rRNA genes,organellar g
26、enes,Chlorella viruses higher plants:organellar genes lower animals(Anthozoans):mitochondrial 1800 known,classified into 12 subgroups,based on secondary structureSplicing of pre-mRNA The introns begin and end with almost invariant sequences:5 GUAG 3 Use ATP hydrolysis to assemble a large spliceosome
27、(45S particle,5 snRNAs and 65 proteins,same size and complexity as ribosome)Mechanism is similar to that of the Group II fungal introns:Initiate splicing with an internal A Uses a phosphoester transfer mechanism for splicingInitiation of phosphoester transfers in pre-mRNAUses 2 OH of an A internal t
28、o the intronForms a branch point by attacking the 5 phosphate on the first nucleotide of the intronForms a lariat structure in the intronExons are joined and intron is excised as a lariatA debranching enzyme cleaves the lariat at the branch to generate a linear intronLinear intron is degradedInvolve
29、ment of snRNAs and snRNPs snRNAs=small nuclear RNAs snRNPs=small nuclear ribonucleoproteins particles(snRNA complex with protein)Addition of these antibodies to an in vitro pre-mRNA splicing reaction blocked splicing.Thus the snRNPs were implicated in splicing Recognizing the 5 splice site and the b
30、ranch site.Bringing those sites together.Catalyzing(or helping to catalyze)the RNA cleavage.Role of snRNPs in RNA splicingRNA-RNA,RNA-protein and protein-protein interactions are all important during splicingsnRNPs U1,U2,U4/U6,and U5 snRNPs Have snRNA in each:U1,U2,U4/U6,U5 Conserved from yeast to h
31、uman Assemble into spliceosome Catalyze splicingSplicing of pre-mRNA occurs in a“spliceosome”an RNA-protein complexpre-mRNAspliced mRNAspliceosome(100 proteins+5 small RNAs)The spliceosome is a large protein-RNA complex in which splicing of pre-mRNAs occurs.Assembly of spliceosome snRNPs are assembl
32、ed progressively into the spliceosome.U1 snRNP binds(and base pairs)to the 5 splice site BBP(branch-point binding protein)binds to the branch site U2 snRNP binds(and base pairs)to the branch point,BBP dissociates U4U5U6 snRNP binds,and U1 snRNP dissociates U4 snRNP dissociates Assembly requires ATP
33、hydrolysis Assembly is aided by various auxiliary factors and splicing factors.Some RNA-RNA hybrids formed during the splicing reactionSteps of the spliceosome-mediated splicing reactionA schematic diagram of six rearrangements that the spliceosome undergoes in mediating the first transesterificatio
34、n reaction in pre-mRNA splicing.Assembly of spliceosomeThe spliceosome cycleThe Significance of Gene Splicing The introns are rare in prokaryotic structural genes The introns are uncommon in lower eukaryote(yeast),239 introns in 6000 genes,only one intron/polypeptide The introns are abundant in high
35、er eukaryotes(lacking introns are histons and interferons)Unexpressed sequences constitute 80%of a typical vertebrate structural gene Errors produced by mistakes in splice-site selectionMechanisms prevent splicing error Co-transcriptional loading process SR proteins recruit spliceosome components to
36、 the 5 and 3 splice sites SR protein=Serine Arginine rich protein ESE=exonic splicing enhancers SR protein regulates alternative splicingAlternative splicing Alternative splicing occurs in all metazoa and is especially prevalent in vertebrateFive ways to splice an RNARegulated alternative splicingDi
37、fferent signals in the pre-mRNA and different proteins cause spliceosomes to form in particular positions to give alternative splicing76575657Fas pre-mRNAAPOPTOSISAlternative splicing can generate mRNAs encoding proteins with different,even opposite functions(programmedcell death)Fas ligandSoluble F
38、as(membrane)FasFas ligand(membrane-associated)(+)(-)Alternative possibilities for 4 exons leave a total number of possible mRNA variations at 38,016.The protein variants are important for wiring of the nervous system and for immune response.Drosophila Dscam gene contains thousands of possible splice
39、 variantsCis-and Trans-SplicingCis-:Splicing in single RNATrans-:Splicing in two different RNAs Y-shaped excised introns(cis-:lariat)Occur in C.elegance and higher eukaryotes but it does in only a few mRNAs and at a very low level pre-mRNA splicingtrans-mRNA splicingspliced leaderSame splicing mecha
40、nism is employed in trans-splicingSpliced leader contains the cap structure!RNA editing RNA editing is the process of changing the sequence of RNA after transcription.In some RNAs,as much as 55%of the nucleotide sequence is not encoded in the(primary)gene,but is added after transcription.Examples:mi
41、tochondrial genes in Trypanosomes（锥虫）Can add,delete or change nucleotides by editingTwo mechanisms mediate editing Guide RNA-directed uridine insertion or deletion Site-specific deaminationInsertion and deletion of nucleotides by editing Uses a guide RNA(in 20S RNP=editosome)that is encoded elsewher
42、e in the genome Part of the guide RNA is complementary to the mRNA in vicinity of editing Trypanosomal RNA editing pathways.(a)Insertion.(b)Deletion.Mammalian example of editingThe C is converted to U in intestine by a specific deaminating enzyme,not by a guide RNA.Cutting and Trimming RNA Can use e
43、ndonucleases to cut at specific sites within a longer precursor RNA Can use exonucleases to trim back from the new ends to make the mature product This general process is seen in prokaryotes and eukaryotes for all types of RNAThe posttranscriptional processing of E.coli rRNA.RNase III cuts in stems
44、of stem-loops16S rRNA23S rRNARNase IIINo apparent primary sequence specificity-perhaps RNase III recognizes a particular stem structure.Eukaryotic rRNA Processing The primary rRNA transcript(7500nt,45S RNA)contains 18S,5.8S and 28S Methylationoccur mostly in rRNA sequence80%:O2-methylribose,20%:base
45、s(A or G)peudouridine 95 U in rRNA in human are converted to Ysmay contribute rRNA tertiary stabilityTransfer RNA Processing Cloverleaf structure CCA:amino acid binding site Anticodon 60 tRNA genes in E.coliA schematic diagram of the tRNA cloverleaf secondary structure.Endo-and exonucleases to gener
46、ate ends of tRNAEndonuclease RNase P cleaves to generate the 5 end.Endonuclease RNase F cleaves 3 nucleotides past the mature 3 end.Exonuclease RNase D trims 3 to 5,leaving the mature 3 end.Splicing of pre-tRNA Introns in pre-tRNA are very short(about 10-20 nucleotides)Have no consensus sequences Ar
47、e removed by a series of enzymatic steps:Cleavage by an endonuclease Phosphodiesterase to open a cyclic intermediate and provide a 3OH Activation of one end by a kinase(with ATP hydrolysis)Ligation of the ends(with ATP hydrolysis)Phosphatase to remove the extra phosphate on the 2OH(remaining after p
48、hosphodiesterase)Steps in splicing of pre-tRNAPOH 52,3 cyclic phosphateExcised intronIntron of 10-20 nucleotides1.Endo-nuclease2.Phospho-diesterase3.Kinase(ATP)4.Ligase(ATP)5.Phosphatase+Spliced tRNACCA at 3 end of tRNAs All tRNAs end in the sequence CCA.Amino acids are added to the CCA end during“c
49、harging”of tRNAs for translation.For most eukaryotic tRNAs,the CCA is added after transcription,in a reaction catalyzed by tRNA nucleotidyl transferase.All of the four bases in tRNA can be modified Pathologies resulting from aberrant splicing can be grouped in two major categories Mutations affectin
50、g proteins that are involved in splicingExamples:Spinal Muscular AtrophyRetinitis PigmentosaMyotonic Dystrophy Mutations affecting a specific messenger RNA and disturbing its normal splicing patternExamples:-ThalassemiaDuchenne Muscular DystrophyCystic FibrosisFrasier SyndromeFrontotemporal Dementia
