1、Chapter 14From Gene to ProteinMetabolism Teaches Us About GenesnMetabolic defectsustudying metabolic diseases suggested that genes specified proteinsnalkaptonuria(black urine from alkapton a.k.a.homogentisic acid)nPKU(phenylketonuria)ueach disease is caused by non-functional enzymeABCDEGenescreateph
2、enotype1 Gene 1 Enzyme HypothesisnBeadle&TatumuCompared mutants of bread mold,Neurospora fungusncreated mutations by X-ray treatmentswX-rays break DNAwinactivate a genenwild type grows on“minimal”mediawsugars+required precursor nutrient to synthesize essential amino acidsnmutants require added amino
3、 acidsweach type of mutant lacks a certain enzyme needed to produce a certain amino acidwnon-functional enzyme=broken geneBeadle&Tatum 1941|1958George BeadleEdward TatumBeadle&Tatums Neurospora ExperimentSo What is a Gene?nOne gene one enzymeuall proteins are coded by genesubut not all proteins are
4、enzymesnOne gene one proteinueach protein has its own geneubut many proteins are composed of several polypeptidesnOne gene one polypeptideubut many genes only code for RNAnOne gene one productubut many genes code for more than one product Where does that leaveus?!Defining a Gene“Defining a gene is p
5、roblematic because one gene can code for several protein products,some genes code only for RNA,two genes can overlap,and there are many other complications.”Elizabeth Pennisi,Science 2003genepolypeptide 1polypeptide 2polypeptide 3RNAgeneIts hard tohunt for wabbits,if you dont knowwhat a wabbitlooks
6、like.proteinRNAThe“Central Dogma”DNAtranscriptiontranslationreplicationnHow do we move information from DNA to proteins?For simplicity sake,lets go back togenes that codefor proteinsFrom nucleus to cytoplasmnWhere are the genes?ugenes are on chromosomes in nucleusnWhere are proteins synthesized?upro
7、teins made in cytoplasm by ribosomes nHow does the information get from nucleus to cytoplasm?umessenger RNAnucleusRNAnribose sugar nN-basesuuracil instead of thymineuU:AuC:Gnsingle strandednmRNA,rRNA,tRNA,siRNA.RNADNAtranscriptionTranscriptionnTranscribed DNA strand=template stranduuntranscribed DNA
8、 strand=coding strandnSynthesis of complementary RNA strandutranscription bubblenEnzyme that facilitates the building of RNA:uRNA polymeraseRole of promoter1.Where to start reading=starting point2.Which strand to read=template strand3.Direction on DNA=always reads DNA 35TranscriptionnInitiationuRNA
9、polymerase binds to promoter sequence on DNA TranscriptionnElongationuRNA polymerase unwinds DNA 20 base pairs at a timeureads DNA 35ubuilds RNA 53(the enzyme governs the synthesis!)No proofreadingn1 error/105 basesnmany copiesnshort lifennot worth it!TranscriptionRNATranscriptionnTermination uRNA p
10、olymerase stops at termination sequenceumRNA leaves nucleus through poresRNA GC hairpin turnProkaryote vs.Eukaryote GeneticsnDifferences between prokaryotes&eukaryotesutime&physical separation between processesuRNA processingTranscription in Eukaryotesnonly 1 prokaryotic enzymen3 eukaryotic RNA poly
11、merase enzymesuRNA polymerase I nonly transcribes rRNA genes uRNA polymerase I I ntranscribes genes into mRNAuRNA polymerase I I I nonly transcribes rRNA genesueach has a specific promoter sequence it recognizesAAA A A3 poly-A tailCH3mRNA55 cap3GPPPEukaryotic Post-transcriptional ProcessingnPrimary
12、transcript ueukaryotic mRNA needs work after transcriptionnProtect mRNAufrom RNA-ase enzymes in cytoplasmnadd 5 G capnadd polyA tailnEdit out intronseukaryoticDNAexon=coding(expressed)sequenceintron=noncoding(inbetween)sequenceprimary mRNAtranscriptmature mRNAtranscriptpre-mRNAspliced mRNA50-250 AsP
13、rimary TranscriptnProcessing mRNAuprotecting RNA from RNase in cytoplasmnadd 5 capnadd polyA tailuremove intronsAUGUGAProtecting RNAn5 cap addeduG trinucleoside(G-P-P-P)uprotects mRNAnfrom RNase(hydrolytic enzymes)n3 poly-A tail addedu50-250 Asuprotects mRNAnfrom RNase(hydrolytic enzymes)uhelps expo
14、rt of RNA from nucleusUTRUTRDicing&Splicing mRNAnPre-mRNA mRNAuedit out intronsnintervening sequencesusplice together exonsnexpressed sequencesuIn higher eukaryotesn90%or more of gene can be intronnno one knows whyyetwtheres a Nobel prize waiting“AVERAGE”“gene”=8000bpre-mRNA=8000bmature mRNA=1200bpr
15、otein=400aalotsa“JUNK”!nsnRNPsusmall nuclear RNAuRNA+proteinsnSpliceosomeuseveral snRNPsurecognize splice site sequencencut&pastenRNA as ribozymeusome mRNA can splice itselfuRNA as enzymeSplicing EnzymesRibozymeSidney AltmanThomas Cech1982|1989YaleU of ColoradonRNA as enzymeSplicing DetailsnNo room
16、for mistakes!uediting&splicing must be exactly accurateua single base added or lost throws off the reading frameAUG|CGG|UCC|GAU|AAG|GGC|CAUAUGCGGCUAUGGGUCCGAUAAGGGCCAUAUGCGGUCCGAUAAGGGCCAUAUG|CGG|GUC|CGA|UAA|GGG|CCA|UAUGCGGCUAUGGGUCCGAUAAGGGCCAUAUGCGGGUCCGAUAAGGGCCAUMet|Arg|Ser|Asp|Lys|Gly|His Met|A
17、rg|Val|Arg|STOP|Alternative SplicingnAlternative mRNAs produced from same geneuwhen is an intron not an intronudifferent segments treated as exonsHardto definea gene!Discovery of Split Genes1977|1993Richard RobertsPhilip SharpNE BioLabsMITadenoviruscommon coldssssssssssssssssssssssssssssssssssssStru
18、cture of Antibodieslight chainsantigen-bindingsiteheavy chainsantigen-bindingsitelightchainlightchainheavychainsB cellmembranevariable regionantigen-binding siteYYYYYYYYYYYYYYYYYYYYYYYYYTranscription of genemRNAchromosome of undifferentiated B cellB cellCCDJDNA of differentiated B cellrearrangement
19、of DNAVTranslation of mRNAHow do vertebrates produce millions of antibody proteins,if they only have a few hundred genes coding for those proteins?antibodyBy DNA rearrangement&somatic mutation vertebrates can produce millions of B&T cells AAAAAAAAGTP20-30b3promotertranscriptionstoptranscriptionstart
20、intronsThe Transcriptional Unit(gene?)transcriptional unitTACACTDNADNATATA5RNApolymerasepre-mRNA53translationstarttranslationstop mature mRNA53UTRUTRexonsenhancer1000+bProkaryote vs.Eukaryote GeneticsnProkaryotesuDNA in cytoplasmucircular chromosomeunaked DNAuno intronsnEukaryotesuDNA in nucleusulin
21、ear chromosomesuDNA wound on histone proteinsuintrons vs.exonseukaryoticDNAexon=coding(expressed)sequenceintron=noncoding(inbetween)sequencemRNAFrom Gene to ProteinDNAtranscriptionnucleuscytoplasmmRNA leaves nucleus through nuclear poresproteins synthesized by ribosomes using instructions on mRNAaaa
22、aaaaaaaaaaaaaribosomeproteintranslationTranslation in ProkaryotesnTranscription&translation are simultaneous in bacteria uDNA is in cytoplasmuno mRNA editing neededTACGCACATTTACGTACGCGGDNAAUGCGUGUAAAUGCAUGCGCCmRNAMet Arg Val Asn Ala Cys Alaprotein?How can you code for 20 amino acids with only 4 nucl
23、eotide bases(A,U,G,C)?How Does DNA Code for ProteinsCracking the CodenNirenberg&Matthaeiudetermined 1st codonamino acid matchnUUU coded for phenylalanineucreated artificial poly(U)mRNA uadded mRNA to test tube of ribosomes,tRNA&amino acidsnmRNA synthesized single amino acid polypeptide chain1960|196
24、8phephephephephepheMarshall NirenbergHeinrich MatthaeiTranslation nCodonsublocks of 3 nucleotides decoded into the sequence of amino acidsmRNA Codes for Proteins in TripletsmRNAAUGCGUGUAAAUGCAUGCGCCmRNAAUGCGUGUAAAUGCAUGCGCCTACGCACATTTACGTACGCGGDNAMet Arg Val Asn Ala Cys Alaprotein?codonmRNA codes fo
25、r proteins in triplets CODONS!The Code!nFor ALL life!ustrongest support for a common origin for all lifenCode is redundantuseveral codons for each amino acidWhy is this a good thing?nStart codonuAUGumethioninenStop codonsuUGA,UAA,UAG5335TACGCACATTTACGTACGCGGDNAAUGCGUGUAAAUGCAUGCGCCmRNAanti-codoncodo
26、nUACMetGCAArgCAUValaminoacidtRNA35How are Codons Matched to Amino Acids?proteinaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaatranscriptioncytoplasmnucleustranslationtRNA Structuren“Clover leaf”structureuanticodon on“clover leaf”enduamino acid attached on 3 endLoading tRNA nAminoacyl tRNA synthetase ue
27、nzyme which bonds amino acid to tRNAuendergonic reactionnATP AMPuenergy stored in tRNA-amino acid bondnunstablenso it can release amino acid at ribosome Ribosomes nFacilitate coupling of tRNA anticodon to mRNA codonuorganelle or enzyme?nStructureuribosomal RNA(rRNA)&proteinsu2 subunitsnlargensmallRi
28、bosomes nP site(peptidyl-tRNA site)uholds tRNA carrying growing polypeptide chainnA site(aminoacyl-tRNA site)uholds tRNA carrying next amino acid to be added to chainnE site(exit site)uempty tRNA leaves ribosome from exit siteBuilding a PolypeptidenInitiationubrings together mRNA,ribosome subunits,p
29、roteins&initiator tRNAnElongationnTerminationElongation:Growing a PolypeptideTermination:Release Polypeptide nRelease factoru“release protein”bonds to A siteubonds water molecule to polypeptide chainNow what happens to the polypeptide?Protein Targeting nSignal peptideuaddress labelDestinations:nsecr
30、etionnnucleusnmitochondrianchloroplastsncell membranencytoplasmex.start of a secretory pathwayCan you tell the eukaryotic story?DNApre-mRNAribosometRNAaminoacidspolypeptidemature mRNA5 cappolyA taillarge subunitsmall subunitaminoacyl tRNAsynthetaseE P A53RNA polymeraseexonintrontRNAPutting it all togetherDont forget the YouTube videos!
